Abstract

Introduction

Materials & Methods

Results

Discussion & Conclusion

References

Discussion
Board

Coomassie Stain and Western blots. Proteins were electrophoresed on 10 or 12% SDS-polyacrylamide gels. For Coomassie staining, the gels were placed in a solution containing 0.25% Coomassie brilliant blue (Sigma) in 45% methanol, 10% acetic acid for 2 hour and washed in the same solution with no dye. For Western blots, the proteins were transferred to PVDF paper (Millipore) and probed with the monoclonal anti-dsyntaxin antibody, 8C3 (courtesy of Dr. S. Benzer) or anti-syntaxin1 antibody, SP5 (40) (gift of Dr. Honer). Protein bands were visualized using HRP conjugated anti-mouse antibodies (BIO-RAD), and ECL system (Amersham).

Purification of recombinant proteins. cDNA clones of dSNAP (41), SNAP-25 and DNA fragment coding for the cytoplasmic portion of VAMP-2 (1-94) were subcloned into pQE-30 (QIAGEN) prokaryotic expression vector. pQE-9-SNAP was a gift of Dr. Whiteheart. pGEX-syntaxin was kindly provided by Dr. R. Scheller. Single colonies were picked and grown in 500 ml cultures of LB broth. 1 mM IPTG was added when the OD at 600nm measurement reached 0.8. The bacteria were grown for a further 3 hours at 37 ^oC or for 7 hours at room temperature. They were spun down and resuspended in 10 ML of lysis buffer containing 0.1 M HEPES pH 7.4, 0.5 M NaCl, 5 mM MgCl₂ plus protease inhibitors. Lysis was done using the French press at 1000 to 1500 psi. after which it was centrifuged at 35,000 RPM in SW41 rotor in Beckman ultra-centrifuge L60. The lysed material was then incubated with either Glutathione-conjugated sepharose beads (Sigma) or Ni-agarose beads (Invitrogen) according to the tag of the recombinant protein, at 4 ^oC for 1-2 hours. His-tagged proteins bound to beads were washed with wash buffer (20 mM HEPES pH 7.4, 0.2 M NaCl, 1mM MgCl₂, 10% glycerol, 2mM beta-mercaptoethanol, 20 mM imidazole). Each protein had a different elution profile with VAMP-2 eluting off at 200 mM imidazole, and SNAP-25 and SNAP at 300 mM imidazole. GST-syntaxin bound to the beads was washed 4 times with 10 ML PBS before elution in 10mM glutathione. The eluted proteins were then dialyzed in binding buffer (see below).

Binding assay and in vitro formation of 7S complex. 0.1 nmole of GST-syntaxin was incubated with 10mL of glutathione-conjugated beads in binding buffer (20 mM HEPES, pH 7.5, 0.5% Triton-X100, and 150 mM NaCl) for 2 hours at 4 ^oC (19). After 4 washes, 0.5 nmole of each his-SNAP-25 and his-VAMP-2 were added in the same buffer and incubated for 16 hours at 4 ^oC. After washes, GST-syntaxin was eluted by 10 mM free glutathione and loaded on the polyacrylamide gel. Same amount of syntaxin was used in binding to SNAP and dSNAP, but the incubation period was only 2 hours long and the beads were boiled in this case, instead of eluting GST-syntaxin. The proteins in each case were electrophoresed and examined by Coomassie stain.

Rt-PCR and sequencing. Poly-A mRNA was isolated from TP-7 comatose (Bloomington Fly Center) fly heads. Fly heads were severed and crushed under liquid N₂ and a 20mg sample was homogenized using Qiagen Shredder. Oligotex conjugated with poly-T (Qiagen) was used to hybridize and isolate poly-A mRNA. 20% of the total mRNA obtained was used for reverse-transcriptase reaction. The reaction was done according to AMV.RT (GIBCO) instructions. PCR was performed on the reverse transcribed mRNA with 5’ oligonucleotides TCCAT1ATGGCTTATATTTTGAAGGCCACCAAA27 and at the corresponding 3’end GCGTCG2235ACTGAAGCGCCACCATGTCGAG2214. The PCR products from several independent experiments were electrophoresed on 1% agarose gels. Of these, two were chosen to be subcloned in both directions into Bluescript SK+ (Stratagene) for sequencing. Complete sequencing in both directions was done and the data was analyzed on ClustalW multiple sequence analysis program.

Fractionation of Fly lysates. Fractionation of Drosophila heads was carried out essentially and described previously (35). Briefly, approximately 1ml Drosophila heads were crushed to fine powder using a mortar under liquid nitrogen and homogenized in 10 ml ice-cold 0.2 M sucrose containing protease inhibitors (3 mM PMSF, 1 mg/ml leupeptin and pepstatin). Cell debris and nuclei were removed by centrifugation of the homogenate at 1000xg for 10 minutes. The supernatant was designated post-nuclear supernatant (PNS). The PNS was further centrifuged at 10,000xg for 10 min and the pellet collected was designated " head pellet". The supernatant (S2) was diluted 1:3 with ice cold 20 mM HEPES-KOH pH 7.5, 0.1 M NaCl and separated on a sucrose step gradient of 0.2 and 0.4 M by spinning at 87,000xg at 4 ^oC for 2 hr. Material which did not enter the gradient was collected as cytosol fraction while the pellet was referred to as head membrane. Synaptic vesicle enriched membrane was collected at the interface of the 0.2 and 0.4 M sucrose. Protein concentration in each fraction was measured by BCA assay (Pierce) and 10 mg of total protein was loaded on the gel for each fraction. For detecting SDS-resistant complexes, duplicate sample of each fraction were mixed with SDS loading buffer and incubated at either 37 ^oC or 100 ^oC for 3 minutes before loading on the gel. The fractions were analyzed by Western blotting with anti-syntaxin antibody.

For heat-shock assays, comatose and wild-type Oregon R flies were heat shock treated for 4 minutes and placed on dry ice to stop any further enzymatic activity. The heads were severed using a blade and homogenized in homogenization buffer (20 mM HEPES, 320 mM sucrose, 1 mM EGTA, 0.1 mM EDTA). Fly lysates were centrifuged at 3000 RPM at 4 ^oC in Eppendorf desktop centrifuge for 10 minutes. Pellets containing nuclei and unbroken tissue were discarded and to the post-nuclear supernatant 0.5% SDS was added and its concentration determined by BCA assay (Pierce).

Back to the top.