Poster Contents
| INABIS '98 Home Page | Your Session | Symposia & Poster Sessions | Plenary Sessions | Exhibitors' Foyer | Personal Itinerary | New Search |
Introduction
Our research goal is to develop a rapid detection assay for pathogenic microbes using nucleic acid hybridization on a mass sensitive biosensor. The specificity in nucleic acid sequences gives a high specificity to an assay designed to detect a particular microbe. The mass sensitive biosensor provides rapid, quantitative analysis for the detection assay. Nucleic acid detection assays use a probe sequence to capture a complementary target sequence. Immobilizing the probe sequence to a solid support matrix optimizes the assay. The support matrix used in our scheme is the synthetic polymer, polyethylene co-acrylic acid (PEAA). This hydrophobic polymer contains carboxylic acid side chains that are available for covalent bonding. The side chains immobilize 5'amino-alkyl substituted ologonucleotide probes by amide bond formation. Bond formation is aided by a carbodiimide catalyst, which binds to the side chains first, then is replaced by the amine-modified oligonuclotides. A potential problem related to this method involves nonspecific binding between the support matrix and the probe or target nucleic acids. In the past, one would overcome this problem, by treatment of the support matrix prior to hybridization, with blocking agents designed to prevent the non-specific binding. Using blocking agents is commonly recommended for support matrices that bind nucleic acids by absorption to increase the signal to noise ratio (2,3). A study by Gingeras, Kwoh, and Davis, who used a dextran support, stated, "prehybridization appears to be required to achieve optimal capture efficiency by the support-bound oligonucleotides (1)." This study suggested that even support matrices that covalently bind oligonucleotide probes needed blocking agents. However, the prehybridization reagents represent two important problems for our mass sensitive detection scheme. First, their application adds to the overall time requirement of the scheme, and second, they interfere with the effectiveness of the mass sensitive biosensor by adding to the background and decreasing the signal to noise ratio. The objective of this study is to determine if the solid support (PEAA) we use with our biosensor would have non-specific binding of free oligonucleotide in the absence of blocking agents.
Materials and Methods
Preparation of PEAA The PEAA film was cut into 2x5mm pieces called chips. The chips were immersed in 50ul of 30% NaOH, heated to 90 for 10 min, and allowed to cool at room temperature for 30 min. After cooling the chips were rinsed with sterile water and stored in 1M sodium phosphate buffer (pH 7). To attach the probe to the chips, each chip was reacted with a solution containing 2ul of 23ug/ul oligonucleotide probe and 50ul of 1M carbodiimide catalyst. The reaction time was five hours. Following the reaction, the chips were washed five times with 1M sodium phosphate buffer (pH 7) and stored at 4°C in the same buffer. Preparation of Oligonucleotides The names and sequences of the oligonucleotides used are shown in Table 1. The target sequences were radiolabeled at the 5' end using 32P labeled ATP and T4 polynucleotide kinase. They were purified on NENSORB columns, dried and reconstituted in 50 ul sterile water. The 5' amino-alkyl substituted oligonucleotide probes were obtained in modified form from Integrated DNA Technologies.
Table 1. Oligonucleotides Sequences Probes E20 5' H2N-alkyl spacer-ATCCGCGAGGGACCTCACCTACATATCAGC SLT 5' H2N-alkyl spacer- CCATGACAACGGACAGCAGTTATACCACTCTGC Targets E20C 5' 32P - GCTGATATGTAGGTGAGGTCCCTCGCGGAT SLTC 5' 32P - GCAGAGTGGTATAACTGCTGTCCGTTGTCATGGHybridization At 23°C Three chips were used in this hybridization; one with SLT immobilized, one with E20 immobilized and one with no probe. Each PEAA chip was placed in a microcentrifuge tube containing 1ul of 16 ug/ul unlabeled SLTC, 8ul of 32P radiolabeled SLTC, and 41 ul of 1M sodium phosphate buffer (pH 7). The cpm/ng for the radiolabeled SLTC was approximately 150. The tubes were incubated for 2 hours at room temperature. Following incubation the chips were transferred to a new tube and washed 5 times with 50 ul of 1 M sodium phosphate buffer (pH 7). The chips were again transferred to a new tube and stored in buffer. At 40°C Three chips were used in this hybridization; two with E20 immobilized and one with no probe. One of the E20 chips was placed in a solution containing 1 ul of 19 ug/ul unlabeled E20C, 8 ul of 32P radiolabeled E20C, and 41 ul of 1M sodium phosphate buffer (pH 7). The cpm/ng for radiolabeled E20C was approximately 100. The chip without bound probe was placed in the same solution. The other E20 chip was placed in the solution used at 23°C. The tubes were placed in a 40°C water bath for 15 min, then incubated at room temperature for 2 hours. The chips were washed and stored with buffer as described above. Scintillation Counting All chips were placed into separate scintillation vials with 50 ul of 1M sodium phosphate buffer (pH 7), 450 ul of sterile water, and 10 ml of Bray's scintillation fluid and counted in a scintillation counter for 10 min.
Results
Under different reaction conditions, we measured the ability of oligonucleotide probes E20 and SLT to bind specifically to their complements, and nonspecifically to each other's complements. We also tested PEAA's ability to bind nonspecifically to both E20C and SLTC. These reactions were run in the absence of any blocking agents. As tables 2 and 3 show, hybridization of complementary probe and target is evident. For example, in table 2, the 502 cpm from the hybridization of E20 with E20C correlates to approximately 5 ng of captured target. From table 3, the hybridization of SLT with SLTC gave 316 cpm and indicated approximately 3 ng of captured target. In both tables the counts obtained from PEAA incubated with radiolabeled target were zero. This indicated that no nucleic acids were bound to PEAA in the absence of covalently bound probe. Thus PEAA has an extremely low binding affinity, either by hydrophobic or ionic action, for nucleic acids. There was less noncomplementary binding relative to complementary binding. This resulted in a 5 to 20 times greater signal to noise ratio for complementary binding. Presumably the signal to noise ratio could be increased even further by increasing the stringency through elevating the hybridization temperature.
Table 2. Sample counts/min % of Specific Binding Signal to Noise Ratio E20 with E20C 502 100 5/1 E20 with SLTC 109 22 PEAA with E20C 0* 0 Scintillation Blank 0 0 *within counting error
Table 3. Sample counts/min % of Specific Binding Signal to Noise Ratio SLT with SLTC 316 100 20/1 E20 with SLTC 18 6 PEAA with SLTC 0* 0 Scintillation Blank 0 0 *within counting error
Discussion and Conclusion
Our results indicate that the need for blocking agents is not universal. The affinity of PEAA for oligonucleotides was very weak in this instance, allowing the detection of hybridization between covalently bound probe and target free in solution. PEAA is an optimal hybridization support for our purposes which involve detection by a mass sensitive biosensor. It may also be well adapted for use in other detection systems that use covalently bound probe for hybridization. Its use would decrease the time and expense incurred from the application of blocking agents.
References
- Gingeras, T.R., D.Y. Kwoh, and G.R. Davis. (1987) Nucl. Acids Res. 15, 5373-5390.
- Keller, G.H. and M.M. Manak. (1993) DNA Probes. Stockton Press. New York.
- Maniatis T., E.F. Fritsch, J. Sambrook. (1989) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York.
| Discussion Board | Previous Page | Your Poster Session |